PCR Amplification of cDNA Inserts for DNA Microarrays

(VandenBosch lab - U. of Minnesota; kvandenb@cbs.umn.edu )


Our cDNA libraries were constructed in pBluescript SK- (Stratagene) using the Uni-Zap XR Vector kit. Phagemid libraries were converted to plasmid libraries via mass excision, using XLOLR as the plating strain of E. coli. Colonies were picked robotically with a Q-bot robot (Genetix), and cultivated in 384 well microtitre plates (see freezer medium).

In our project, clones are selected for expression analysis based on sequencing results. Selected clones are rearrayed in 96 well plates containing freezer medium to make glycerol stocks for the microarrays. To grow bacteria for production of DNA for the arrays, cultures are grown overnight in LB medium in a 96 well format, and the clone inserts are amplified from the bacterial cultures with out purification of the DNA. The PCR amplification conditions are given below.
 

REACTION MIX

Components Volume Final concentration
10 x buffer* 5 ul 1x
MgCl2 (25mM) 3 ul 1.5 mM
dNTP (10 mM) 1 ul 200 mM
Primers**:
T7 22-mer primer OD: 1.0 1 ul
SK 20-mer primer OD: 1.0 1 ul
Taq polymerase 0.2 ul 1 unit
sterile water 36.8 ul
template bacterial culture 2 ul
Total 50 ul

* We use buffer from Promega.

** T7 and SK are sequencing primers, specified by Stratagene, that flank the insert. We prefer SK over T3 because it is closer to the cloning site. We make stocks of each primer with O.D. = 1.
T7 22-mer primer = 5' GTAATACGACTCACTATAGGGC 3'.
SK 20-mer primer = 5' CGCTCTAGAACTAGTGGATC 3'

AMPLIFICATION

Amplification is run in a 96 well format in an MJ Research PTC-100 programable thermal cycler, using 0.2 ul plates. The PCR amplification program is as follows:
 First denaturation: 95oC for 10 minutes
 35 cycles of: 94oC for 30 seconds
60oC for 1 minute
72oC for 1 minute
 Final Polymerization: 72oC for 4 minutes
 Hold at:  4oC

Check success of amplification by running 5 microliters (5 ul) of amplification products on an agarose gel.

2000.05.20
 
 

Aeroponic chamber|Cultivation|DNA extraction|EMS Mutagenesis|
Freezer Medium|PCR Amplification|Seed Germination|Seed Mill|
Medicago.org